Skip to main content

pDR-AmTrac
(Plasmid #47770)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47770 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDR GW
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 8200
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AmTrac
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    2229
  • Promoter PMA
  • Tag / Fusion Protein
    • mcpGFP

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer aacaatcgttaataattaattaattgg
  • 3′ sequencing primer gaagtgtcaacaacgtatctacc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDR-AmTrac was a gift from Wolf Frommer (Addgene plasmid # 47770 ; http://n2t.net/addgene:47770 ; RRID:Addgene_47770)
  • For your References section:

    Fluorescent sensors reporting the activity of ammonium transceptors in live cells. De Michele R, Ast C, Loque D, Ho CH, Andrade SL, Lanquar V, Grossmann G, Gehne S, Kumke MU, Frommer WB. eLife. 2013 Jul 2;2:e00800. 10.7554/eLife.00800 PubMed 23840931