pLew90β-GW/T7/PARP SAS/luciferase/Aldolase 3′UTR
(Plasmid
#48157)
-
PurposeTransgenically expresses firefly luciferase protein in T. cruzi
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48157 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepLew90β-T7-GW-Neo
-
Backbone manufacturerCourtney Boehlke
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 8000
-
Modifications to backbonesee paper
-
Vector typeLuciferase ; T. cruzi expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameluciferase
-
Alt namefirefly luciferase
-
SpeciesP. pyralis
-
Insert Size (bp)1640
- Promoter T7
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypPT7:Otet/Luc vector (a gift from John E. Donelson, University of Iowa, Iowa City, IA)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLew90β-GW/T7/PARP SAS/luciferase/Aldolase 3′UTR was a gift from Rick Tarleton (Addgene plasmid # 48157 ; http://n2t.net/addgene:48157 ; RRID:Addgene_48157) -
For your References section:
In vitro and in vivo high-throughput assays for the testing of anti-Trypanosoma cruzi compounds. Canavaci AM, Bustamante JM, Padilla AM, Perez Brandan CM, Simpson LJ, Xu D, Boehlke CL, Tarleton RL. PLoS Negl Trop Dis. 2010 Jul 13;4(7):e740. doi: 10.1371/journal.pntd.0000740. 10.1371/journal.pntd.0000740 PubMed 20644616