Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pLew90β-GW/T7/PARP SAS/luciferase/Aldolase 3′UTR
(Plasmid #48157)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 48157 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pLew90β-T7-GW-Neo
  • Backbone manufacturer
    Courtney Boehlke
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 8000
  • Modifications to backbone
    see paper
  • Vector type
    Luciferase ; T. cruzi expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    luciferase
  • Alt name
    firefly luciferase
  • Species
    P. pyralis
  • Insert Size (bp)
    1640
  • Promoter T7

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pPT7:Otet/Luc vector (a gift from John E. Donelson, University of Iowa, Iowa City, IA)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLew90β-GW/T7/PARP SAS/luciferase/Aldolase 3′UTR was a gift from Rick Tarleton (Addgene plasmid # 48157 ; http://n2t.net/addgene:48157 ; RRID:Addgene_48157)
  • For your References section:

    In vitro and in vivo high-throughput assays for the testing of anti-Trypanosoma cruzi compounds. Canavaci AM, Bustamante JM, Padilla AM, Perez Brandan CM, Simpson LJ, Xu D, Boehlke CL, Tarleton RL. PLoS Negl Trop Dis. 2010 Jul 13;4(7):e740. doi: 10.1371/journal.pntd.0000740. 10.1371/journal.pntd.0000740 PubMed 20644616