-
Purposeretroviral vector encoding for GFP and Cre-recombinase
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 48201 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCAG-GFP
-
Backbone manufacturerGage lab (Addgene plasmid# 16664)
- Backbone size w/o insert (bp) 6764
- Total vector size (bp) 9328
-
Modifications to backbonevector backbone based on the pCL system by Naviaux et al.,J. Virol. 70, 5701–5705 (1996).
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameeGFP
-
Alt nameEnhanced Green Fluorescent Protein
-
Alt nameN/A
-
Alt nameN/A
-
SpeciesAequorea victoria green
-
Insert Size (bp)700
-
GenBank ID
- Promoter CAG
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CTC GGC AAC GTG CTG GTT GTT
- 3′ sequencing primer CAACATAGTTAAGAATACCAGTC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCre
-
Alt nameCre-recombinase
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)991
-
GenBank ID
- Promoter linked by IRES
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer IRES-F
- 3′ sequencing primer WPRE-R
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-GFP-IRES-CRE was a gift from Fred Gage (Addgene plasmid # 48201 ; http://n2t.net/addgene:48201 ; RRID:Addgene_48201) -
For your References section:
Distinct morphological stages of dentate granule neuron maturation in the adult mouse hippocampus. Zhao C, Teng EM, Summers RG, Ming GL, Gage FH. J Neurosci. 2006 Jan 4. 26(1):3-11. 10.1523/JNEUROSCI.3648-05.2006 PubMed 16399667