Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CAG-GFP/cre
(Plasmid #49054)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49054 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    CAG-GFP
  • Backbone manufacturer
    Gage lab (Addgene plasmid# 16664)
  • Backbone size w/o insert (bp) 6817
  • Total vector size (bp) 8681
  • Modifications to backbone
    vector backbone based on the pCL system by Naviaux et al.,J. Virol. 70, 5701–5705 (1996).
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP/Cre
  • Alt name
    GFP-fused Cre recombinase
  • Species
    Synthetic
  • Insert Size (bp)
    1870
  • GenBank ID
  • Promoter CAG

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTC GGC AAC GTG CTG GTT GTT
  • 3′ sequencing primer CAACATAGTTAAGAATACCAGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG-GFP/cre was a gift from Fred Gage (Addgene plasmid # 49054 ; http://n2t.net/addgene:49054 ; RRID:Addgene_49054)
  • For your References section:

    Retrovirus-mediated single-cell gene knockout technique in adult newborn neurons in vivo. Tashiro A, Zhao C, Gage FH. Nat Protoc. 2006;1(6):3049-55. 10.1038/nprot.2006.473 PubMed 17406567