CAG-GFP-IRES-CRE
(Plasmid #48201)

• Purpose: retroviral vector encoding for GFP and Cre-recombinase
• Depositing Lab: Fred Gage
• Publication: Zhao et al J Neurosci. 2006 Jan 4. 26(1):3-11.

Backbone

• Vector backbone: CAG-GFP
• Backbone manufacturer: Gage lab (Addgene plasmid# 16664)
• Backbone size w/o insert (bp): 6764
• Total vector size (bp): 9328
• Modifications to backbone: vector backbone based on the pCL system by Naviaux et al.,J. Virol. 70, 5701–5705 (1996).
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: eGFP
• Alt name: Enhanced Green Fluorescent Protein
• Alt name: N/A
• Alt name: N/A
• Species: Aequorea victoria green
• Insert Size (bp): 700
• GenBank ID:
• Promoter: CAG

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CTC GGC AAC GTG CTG GTT GTT
• 3′ sequencing primer: CAACATAGTTAAGAATACCAGTC

Gene/Insert 2

• Gene/Insert name: Cre
• Alt name: Cre-recombinase
• Species: M. musculus (mouse)
• Insert Size (bp): 991
• GenBank ID:
• Promoter: linked by IRES

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: IRES-F
• 3′ sequencing primer: WPRE-R

Resource Information

• Supplemental Documents:
  • genebank sequence
• Articles Citing this Plasmid:
  • 14 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry