-
PurposeGenetically encoded fluorescent indicator for measuring NAD/NADH ratio.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48247 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepC1
- Backbone size w/o insert (bp) 3982
- Total vector size (bp) 5370
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameREX-YFP
-
SpeciesSynthetic
-
Insert Size (bp)1389
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer cggtgggaggtctatataag
- 3′ sequencing primer tgggaggttttttaaagcaag (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC1-REX-YFP was a gift from Vsevolod Belousov (Addgene plasmid # 48247 ; http://n2t.net/addgene:48247 ; RRID:Addgene_48247) -
For your References section:
Genetically encoded fluorescent indicator for imaging NAD/NADH ratio changes in different cellular compartments. Bilan DS, Matlashov ME, Gorokhovatsky AY, Schultz C, Enikolopov G, Belousov VV. Biochim Biophys Acta. 2013 Nov 25. pii: S0304-4165(13)00519-9. doi: 10.1016/j.bbagen.2013.11.018. 10.1016/j.bbagen.2013.11.018 PubMed 24286672