Gal1/10 His6 TEV Ade S. cerevisiae expression vector (12ADE-B)
(Plasmid
#48298)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 48298 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS422
- Backbone size (bp) 8488
-
Vector typeNA
-
Tag
/ Fusion Protein
- His6 (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function.
This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
This vector has a TEV cleavable His6 tag on the N-terminus and can complement Ade auxotrophy.
Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-).For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Gal1/10 His6 TEV Ade S. cerevisiae expression vector (12ADE-B) was a gift from Scott Gradia (Addgene plasmid # 48298 ; http://n2t.net/addgene:48298 ; RRID:Addgene_48298)