pHJ17
(Plasmid
#48356)
-
PurposeTargets beta-Tubulin for Cre-lox mediated knockout in T. brucei, Hygromycin/Gancyclovir selectable
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 48356 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHD309
-
Backbone manufacturerCross Lab
- Total vector size (bp) 6261
-
Vector typeCre/Lox ; Knockout in T. Brucei
-
Selectable markersHygromycin ; Gancyclovir
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePartial beta-TUB followed by 5' ALD UTR-loxP-SAS-HYG-Ty1-TK-loxP-3' ALD UTR
-
SpeciesT. brucei
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tb#44 CTGGTTAGTATGGACTTCTCTAGA
- 3′ sequencing primer pBRrevBam
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html
There are several mismatches between Addgene's quality control sequence and the reference sequence from the depositing lab; most notably in the beta-tubulin ORF, HSV thymidine kinase and the T. brucei Aldolase 3'UTR. These mismatches should not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHJ17 was a gift from George Cross (Addgene plasmid # 48356 ; http://n2t.net/addgene:48356 ; RRID:Addgene_48356) -
For your References section:
Strategies to construct null and conditional null Trypanosoma brucei mutants using Cre-recombinase and loxP. Kim HS, Li Z, Boothroyd C, Cross GA. Mol Biochem Parasitol. 2013 Aug 13;191(1):16-19. doi: 10.1016/j.molbiopara.2013.08.001. 10.1016/j.molbiopara.2013.08.001 PubMed 23954366