Skip to main content

pEF5B-FRT-AP-Smo-YFP-DEST
(Plasmid #49099)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49099 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEF5B
  • Backbone size w/o insert (bp) 6833
  • Total vector size (bp) 8350
  • Modifications to backbone
    Gateway Cloning DEST vector from Life Technologies
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Mach T1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Smo
  • Alt name
    Smoothened
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2408
  • Entrez Gene
    Smo (a.k.a. E130215L21Rik, Smoh, bnb, smoothened)
  • Promoter T7
  • Tags / Fusion Proteins
    • acceptor peptide (AP) (N terminal on insert)
    • YFP (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGGCCGCTGGCCGCCCC
  • 3′ sequencing primer CTACAGCTCGTCCATGCCGAGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    AP-SMO-YFP was a gift from Dr. Carolyn Ott in Jennifer Lipincott-Schwartz lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEF5B-FRT-AP-Smo-YFP-DEST was a gift from Maxence Nachury (Addgene plasmid # 49099 ; http://n2t.net/addgene:49099 ; RRID:Addgene_49099)
  • For your References section:

    Single molecule imaging reveals a major role for diffusion in the exploration of ciliary space by signaling receptors. Ye F, Breslow DK, Koslover EF, Spakowitz AJ, Nelson WJ, Nachury MV. Elife. 2013 Aug 6;2:e00654. doi: 10.7554/eLife.00654. Print 2013. 10.7554/eLife.00654 PubMed 23930224