Skip to main content

pAAV-FLEX-C-RG
(Plasmid #49101)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 49101 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-EF1a-FLEX-GTB
  • Backbone manufacturer
    Callaway Addgene 26197
  • Total vector size (bp) 8022
  • Modifications to backbone
    Replaced GFP-TVA in pAAV-EF1a-FLEX-GTB with Cerulean
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cerulean-E2A-RG
  • Alt name
    rabies virus glycoprotein
  • Species
    rabies virus
  • Insert Size (bp)
    2367
  • Promoter EF1a
  • Tag / Fusion Protein
    • cerulean (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer atttgccctttttgagtttgg
  • 3′ sequencing primer CAAGGCTGGTGGGCACTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The original plasmid is Addgene Plasmid #26197,
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

GFP-2A-TVA in pAAV-EF1a-Flex-GTB is replaced with cerulean.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-FLEX-C-RG was a gift from Troy Margrie (Addgene plasmid # 49101 ; http://n2t.net/addgene:49101 ; RRID:Addgene_49101)