Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #49101)


Item Catalog # Description Quantity Price (USD)
Plasmid 49101 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Callaway Addgene 26197
  • Total vector size (bp) 8022
  • Modifications to backbone
    Replaced GFP-TVA in pAAV-EF1a-FLEX-GTB with Cerulean
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    rabies virus glycoprotein
  • Species
    rabies virus
  • Insert Size (bp)
  • Promoter EF1a
  • Tag / Fusion Protein
    • cerulean (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer atttgccctttttgagtttgg
  • 3′ sequencing primer CAAGGCTGGTGGGCACTGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

GFP-2A-TVA in pAAV-EF1a-Flex-GTB is replaced with cerulean.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-FLEX-C-RG was a gift from Troy Margrie (Addgene plasmid # 49101)