pet28a-ClbB-NRPS-NHis
(Plasmid
#49217)
-
PurposeNRPS module of ClbB containing CAT domains with N-terminal 6His tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49217 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28a (+)
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5364
- Total vector size (bp) 8601
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameClbB-NRPS
-
SpeciesEscherichia coli CFT073
-
Insert Size (bp)3245
-
Mutationcontains aa4-1080 of reference sequence NP_754362.1
-
GenBank IDNP_754362.1
- Promoter T7
-
Tags
/ Fusion Proteins
- 6x His tag (N terminal on backbone)
- T7 tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TTAATTGCGGCCGCATGGATAATACCTCTG
- 3′ sequencing primer AGTCATCTCGAGTCACGTTGGAATTGCATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pet28a-ClbB-NRPS-NHis was a gift from Emily Balskus (Addgene plasmid # 49217 ; http://n2t.net/addgene:49217 ; RRID:Addgene_49217) -
For your References section:
A prodrug resistance mechanism is involved in colibactin biosynthesis and cytotoxicity. Brotherton CA, Balskus EP. J Am Chem Soc. 2013 Mar 6;135(9):3359-62. doi: 10.1021/ja312154m. Epub 2013 Feb 20. 10.1021/ja312154m PubMed 23406518