Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #49219)


Item Catalog # Description Quantity Price (USD)
Plasmid 49219 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Total vector size (bp) 6998
  • Vector type
    Mammalian Expression, Retroviral, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter Viral LTR (or CMV)
  • Tag / Fusion Protein
    • SfuI site to create C-terminal fusions (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer GGATACACGCCGCCCACGTG (5' to 3')
  • 3′ sequencing primer AGGGCGAGGGCGATGCCACCTA (5' to 3')
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter Viral LTR (or CMV)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GTCACCTTCAGCTTGGCGG (5' to 3')
  • 3′ sequencing primer ATGGCGTTACTTAAGCTAG (5' to 3')
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Vector allows for control of transgene expression at the level of translation. It is 1 vector in a set of 9 that spans a range of expression levels. Sequencing through any part of the IRES sequence is not advised. Expression of gene downstream of IRES remains constant, despite varying expression of gene upstream.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCru5-ACC/ACC/ACC-mEGFP-IRES-mCherry was a gift from Clifford Wang (Addgene plasmid # 49219 ; ; RRID:Addgene_49219)
  • For your References section:

    Tuning gene expression with synthetic upstream open reading frames. Ferreira JP, Overton KW, Wang CL. Proc Natl Acad Sci U S A. 2013 Jul 9;110(28):11284-9. doi: 10.1073/pnas.1305590110. Epub 2013 Jun 24. 10.1073/pnas.1305590110 PubMed 23798422