Skip to main content

pBiFC-HA-hCaspase 2 CARD-VC155
(Plasmid #49259)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49259 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBiFC-NC155
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 4360
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Caspase-2 CARD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    366
  • Mutation
    deleted aa 123-435
  • GenBank ID
    U13021
  • Entrez Gene
    CASP2 (a.k.a. CASP-2, ICH1, MRT80, NEDD-2, NEDD2, PPP1R57)
  • Promoter CMV
  • Tags / Fusion Proteins
    • HA (N terminal on backbone)
    • split Venus C (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer atgtacccatacgatgttccag
  • 3′ sequencing primer tgcttgtcgtggttcatgac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBiFC-HA-hCaspase 2 CARD-VC155 was a gift from Douglas Green (Addgene plasmid # 49259 ; http://n2t.net/addgene:49259 ; RRID:Addgene_49259)
  • For your References section:

    Characterization of cytoplasmic caspase-2 activation by induced proximity. Bouchier-Hayes L, Oberst A, McStay GP, Connell S, Tait SW, Dillon CP, Flanagan JM, Beere HM, Green DR. Mol Cell. 2009 Sep 24;35(6):830-40. doi: 10.1016/j.molcel.2009.07.023. 10.1016/j.molcel.2009.07.023 PubMed 19782032