-
PurposeExpresses a Delta-set deletion mutant of Flag Tagged Ezh2. Hygromycin resistant.
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49403 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMSCV-hygro
-
Modifications to backbonenone
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3prime end of Flag-mus-Ezh2deltaSET, eliminating Set domain
-
Alt nameEZH2
-
Alt nameistone-lysine N-methyltransferase
-
SpeciesM. musculus (mouse)
-
MutationSet domain deleted
- Promoter MSCV promotor
-
Tag
/ Fusion Protein
- Flag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bglii (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer TCAATATAATGATGATGATGATGACG
- 3′ sequencing primer CCAGAGGCCACTTGTGTAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene, Plasmid 24926: MSCVhygro-F-Ezh2 From Kai Ge
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This was cloned using fusion polymerase but the sequence has not been confirmed.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-FlagmuEzh2deltaset-Hygro was a gift from Tobias Neff (Addgene plasmid # 49403 ; http://n2t.net/addgene:49403 ; RRID:Addgene_49403)