JpExpress404 PTEN-LONG
(Plasmid #49417)

• Purpose: Bacterial Expression Vector
• Depositing Lab: Ramon Parsons
• Publication: Hopkins et al Science. 2013 Jul 26;341(6144):399-402. doi: 10.1126/science.1234907. Epub 2013 Jun 6.

Backbone

• Vector backbone: JpExpress404
• Backbone manufacturer: DNA2.0
• Backbone size w/o insert (bp): 3968
• Total vector size (bp): 5793
• Modifications to backbone: N/A
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PTEN-Long
• Entrez Gene: PTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)
• Promoter: T5

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: pNI-Rev (CGTTGCTTTTTCGATTGATG)
• 3′ sequencing primer: rrnB_T1_term-F (ACGAAAGGCTCAGTCGAAAG)

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • DNA 2.0 Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The PTEN nucleotide sequence in this plasmid has been codon optimized for expression in bacteria.