Skip to main content
Addgene

GBK-Rab4BQ67LdeltaGCG
(Plasmid #49557)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49557 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    GBK-T7
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 7300
  • Total vector size (bp) 7900
  • Vector type
    Yeast Expression
  • Selectable markers
    Neomycin (select with G418), TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab4BAQ67LdeltaCGC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    600
  • Mutation
    Glutamine 67 to Leucine, deleted amino acids Cysteine 212, Glycine 213, Cysteine 214
  • GenBank ID
    AF498935
  • Promoter ADHI
  • Tags / Fusion Proteins
    • Gal4 Binding Domain (N terminal on insert)
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI/SalI (destroyed during cloning)
  • 5′ sequencing primer T7 (TAATACGACTCACTATAGGG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Rab4B cDNA derived from pCDNA3.1+Rab4B purchased from Missouri S&T cDNA Resource Center

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GBK-Rab4BQ67LdeltaGCG was a gift from Marci Scidmore (Addgene plasmid # 49557)
  • For your References section:

    Chlamydia pneumoniae inclusion membrane protein Cpn0585 interacts with multiple Rab GTPases. Cortes C, Rzomp KA, Tvinnereim A, Scidmore MA, Wizel B. Infect Immun. 2007 Dec;75(12):5586-96. Epub 2007 Oct 1. 10.1128/IAI.01020-07 PubMed 17908815