GBK-Rab4BQ67LdeltaGCG
(Plasmid
#49557)
-
Purposeexpresses GAL4BD-Rab4BQ67LdeltaCGCin yeast
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49557 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneGBK-T7
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7300
- Total vector size (bp) 7900
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418), TRP1
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab4BAQ67LdeltaCGC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)600
-
MutationGlutamine 67 to Leucine, deleted amino acids Cysteine 212, Glycine 213, Cysteine 214
-
GenBank IDAF498935
- Promoter ADHI
-
Tags
/ Fusion Proteins
- Gal4 Binding Domain (N terminal on insert)
- Myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI/SalI (destroyed during cloning)
- 5′ sequencing primer T7 (TAATACGACTCACTATAGGG)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRab4B cDNA derived from pCDNA3.1+Rab4B purchased from Missouri S&T cDNA Resource Center
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GBK-Rab4BQ67LdeltaGCG was a gift from Marci Scidmore (Addgene plasmid # 49557) -
For your References section:
Chlamydia pneumoniae inclusion membrane protein Cpn0585 interacts with multiple Rab GTPases. Cortes C, Rzomp KA, Tvinnereim A, Scidmore MA, Wizel B. Infect Immun. 2007 Dec;75(12):5586-96. Epub 2007 Oct 1. 10.1128/IAI.01020-07 PubMed 17908815