- 
            Purposeexpresses the plekstrin homology domain of OSBP in mammalian cells
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49571 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneEGFP C2
- 
              Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5000
- 
              Vector typeMammalian Expression
- 
                Selectable markersNeomycin (select with G418)
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameOSBP-PH (AA 91-179)
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)300
- 
                    GenBank IDNM_002556.2
- 
                        Entrez GeneOSBP (a.k.a. OSBP1)
- Promoter CMV
- 
    
        Tag
        / Fusion Protein
    - EGFP (N terminal on insert)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI/SalI (destroyed during cloning)
- 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG) (Common Sequencing Primers)
Resource Information
- 
            A portion of this plasmid was derived from a plasmid made byOSBP derived from cMV6-XL6-OSBP purchased from Origene
- 
            Articles Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: EGFP-OSBP-PH was a gift from Marci Scidmore (Addgene plasmid # 49571 ; http://n2t.net/addgene:49571 ; RRID:Addgene_49571)
- 
                For your References section: Multiple host proteins that function in phosphatidylinositol-4-phosphate metabolism are recruited to the chlamydial inclusion. Moorhead AM, Jung JY, Smirnov A, Kaufer S, Scidmore MA. Infect Immun. 2010 May;78(5):1990-2007. doi: 10.1128/IAI.01340-09. Epub 2010 Mar 15. 10.1128/IAI.01340-09 PubMed 20231409
 
    
 
                         
             
            