SLIRP.HMG6.wt.fl
(Plasmid
#49821)
-
Purposeexpression vector for MBP-SLIRP fusion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49821 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHMG6
-
Backbone manufacturernone
- Backbone size w/o insert (bp) 6518
- Total vector size (bp) 6786
-
Modifications to backboneCodon-optimized for E. coli expression; ORF cloned into pHMG6 vector using TAGGGTACCGCGGCCGCCTCGAG extension from the 'stop' codon which has KpnI, EagI and XhoI sites.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Growth instructionsfor expression of protein, grown in BL21(DE3)
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSLIRP SRA stem-loop interacting RNA binding protein
-
SpeciesH. sapiens (human)
-
Insert Size (bp)330
-
Mutationwildtype codon-optimized for E. coli expression
-
GenBank IDNM_031210
-
Entrez GeneSLIRP (a.k.a. C14orf156, DC50, PD04872)
- Promoter T7
-
Tag
/ Fusion Protein
- E. coli Maltose Binding Protein (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer MBP internal primer: GCGGTCGTCAGACTGTCGATG
- 3′ sequencing primer T7 terminator (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypHMG6 was from Berkeley Center for Structural Genomics; insertion of hSLIRP construct was done by this investigator
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SLIRP.HMG6.wt.fl was a gift from Thomas Cech (Addgene plasmid # 49821 ; http://n2t.net/addgene:49821 ; RRID:Addgene_49821) -
For your References section:
Structure and function of steroid receptor RNA activator protein, the proposed partner of SRA noncoding RNA. McKay DB, Xi L, Barthel KK, Cech TR. J Mol Biol. 2014 Apr 17;426(8):1766-85. doi: 10.1016/j.jmb.2014.01.006. Epub 2014 Jan 30. 10.1016/j.jmb.2014.01.006 PubMed 24486609