pcDNA3.1(-)-PM-Cpalm-HA-SrtA (pKS37)
(Plasmid
#50031)
-
PurposeExpression of S. pyogenes SrtA at the plasma membrane in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 50031 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1(-)
-
Backbone manufacturerInvtrogen
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 6000
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePM-SrtA(strep)
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)622
- Promoter pCMV
-
Tag
/ Fusion Protein
- C-HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (destroyed during cloning)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(-)-PM-Cpalm-HA-SrtA (pKS37) was a gift from Hidde Ploegh (Addgene plasmid # 50031 ; http://n2t.net/addgene:50031 ; RRID:Addgene_50031) -
For your References section:
Protein ligation in living cells using sortase. Strijbis K, Spooner E, Ploegh HL. Traffic. 2012 Jun;13(6):780-9. doi: 10.1111/j.1600-0854.2012.01345.x. Epub 2012 Mar 23. 10.1111/j.1600-0854.2012.01345.x PubMed 22348280