Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pVITRO1-102.1F10-IgG2/λ
(Plasmid #50367)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50367 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pVITRO1-hygro-mcs
  • Backbone manufacturer
    InvivoGen
  • Backbone size w/o insert (bp) 6491
  • Total vector size (bp) 8553
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    grass pollen allergen Phl p 7 specific human Gamma 2 heavy chain expression cassette
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1398
  • Promoter Mouse Elongation Factor 1 Alpha

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TTTTGAGCGGAGCTAATTCTCGGG
  • 3′ sequencing primer AAAAAACCTCCCACACCTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    711
  • Promoter Rat Elongation Factor 1 Alpha

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GAGGCTAATTCTCAAGCCTC
  • 3′ sequencing primer TCTAGACCTGGAAAGACCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVITRO1-102.1F10-IgG2/λ was a gift from Andrew Beavil (Addgene plasmid # 50367 ; http://n2t.net/addgene:50367 ; RRID:Addgene_50367)
  • For your References section:

    A tool kit for rapid cloning and expression of recombinant antibodies. Dodev TS, Karagiannis P, Gilbert AE, Josephs DH, Bowen H, James LK, Bax HJ, Beavil R, Pang MO, Gould HJ, Karagiannis SN, Beavil AJ. Sci Rep. 2014 Jul 30;4:5885. doi: 10.1038/srep05885. 10.1038/srep05885 PubMed 25073855