pME-puro-Venus-FLAG-CD59
(Plasmid #50377)

• Purpose: Express Venus and FLAG-tagged human CD59, a GPI-AP in mammalian cells
• Depositing Lab: Reika Watanabe
• Publication: Rivier et al Traffic. 2010 Aug;11(8):1017-33. doi: 10.1111/j.1600-0854.2010.01081.x. Epub 2010 May 11.

Backbone

• Vector backbone: pME-puro-FLAG-CD59
• Backbone size w/o insert (bp): 5500
• Total vector size (bp): 6200
• Modifications to backbone: Venus was amplified by PCR from pBS7 (Yeast Resource Center) using upper and lower primers both containing SbfI sites and integrated into the pME-puro-FLAG-CD59 plasmid at the SbfI site.
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Venus
• Alt name: Venus-FLAG-CD59
• Species: Synthetic
• Insert Size (bp): 700
• Promoter: SR alpha

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SbfI (not destroyed)
• 3′ cloning site: SbfI (not destroyed)
• 5′ sequencing primer: agtaaaggagaagaacttttc
• 3′ sequencing primer: tttgtatagttcatccatgcc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please click View Sequences link for full plasmid sequence of vector backbone pME-puro-FLAG-CD59.