Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pME-mCherry-FLAG-CD59-GPI
(Plasmid #50378)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50378 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pME-FLAG-CD59-GPI
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 6200
  • Modifications to backbone
    mCherry was amplified by PCR from pBS35 (Yeast Resource Center) by using upper and lower primers both containing NsiI sites and integrated into the pME-FLAG-CD59-GPI at SbfI site
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Alt name
    mCherry-FLAG-CD59
  • Species
    Synthetic
  • Insert Size (bp)
    700
  • Promoter SR alpha

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SbfI (destroyed during cloning)
  • 3′ cloning site SbfI (destroyed during cloning)
  • 5′ sequencing primer gtgagcaagggcgaggaggat
  • 3′ sequencing primer cttgtacagctcgtccatgcc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Roger Tsien, PhD, Professor of Pharmacology at UC San Diego
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pME-mCherry-FLAG-CD59-GPI was a gift from Reika Watanabe (Addgene plasmid # 50378 ; http://n2t.net/addgene:50378 ; RRID:Addgene_50378)
  • For your References section:

    Exit of GPI-anchored proteins from the ER differs in yeast and mammalian cells. Rivier AS, Castillon GA, Michon L, Fukasawa M, Romanova-Michaelides M, Jaensch N, Hanada K, Watanabe R. Traffic. 2010 Aug;11(8):1017-33. doi: 10.1111/j.1600-0854.2010.01081.x. Epub 2010 May 11. 10.1111/j.1600-0854.2010.01081.x PubMed 20477992