pAAV-EF1a-DIO-hM3D(Gq)-mCherry
(Plasmid #50460)

• Purpose: Double floxed Gq-coupled hM3D DREADD fused with mCherry under the control of EF1a promoter
• Depositing Lab: Bryan Roth
• Publication: Roth lab DREADDs (unpublished)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	50460	Standard format: Plasmid sent in bacteria as agar stab	1	$65	Add to Cart
AAV5	50460-AAV5	Viral service discontinued. See similar plasmid (Syn promoter) 44361.	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30	$380	Discontinued

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pAAV
  (Search Vector Database)
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 8105
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: hM3D(Gq)-mCherry
• Species: H. sapiens (human)
• Insert Size (bp): 2508
• Mutation: See supplemental documents for DREADD mutations
• Entrez Gene: CHRM3 (a.k.a. EGBRS, HM3, PBS)
• Promoter: EF1a
• Tags / Fusion Proteins:
  • HA (N terminal on insert)
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Asc I (not destroyed)
• 3′ cloning site: Nhe I (not destroyed)
• 5′ sequencing primer: TTTTTGAGTTTGGATCTTGG
• 3′ sequencing primer: GCATTAAAGCAGCGTATCCACATAGC

Resource Information

• Supplemental Documents:
  • DREADD mutations
• Addgene Notes:
  • Addgene diagnostic digest
• Terms and Licenses:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
  • genOway Notice of RIghts
• Articles Citing this Plasmid:
  • 6 References

Depositor Comments

For more information, see: http://pdspit3.mml.unc.edu/projects/dreadd/wiki/WikiStart

Information for AAV5 (Catalog # 50460-AAV5)

Item is discontinued.

Addgene no longer distributes this item. Contact for more information.

Viral service discontinued. See similar plasmid (Syn promoter) 44361.

Purpose

Ready-to-use AAV5 particles produced from pAAV-EF1a-DIO-hM3D(Gq)-mCherry (#50460). In addition to the viral particles, you will also receive purified pAAV-EF1a-DIO-hM3D(Gq)-mCherry plasmid DNA.

CNO-induced neuronal burst firing. EF1a-driven with mCherry reporter. Cre-dependent. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: .
• Titer: ≥ 3×10¹² vg/mL
• Pricing: $350 USD for preparation of . virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene
• Envelope: AAV5 cap gene
• Buffer: PBS + 0.001% Pluronic F-68 + 200 mM NaCl
• Serotype: AAV5
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: mCherry

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

• Terms and Licenses:
  • Terms of Use for Viral Vectors

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.