Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #50462)


Item Catalog # Description Quantity Price (USD)
Plasmid 50462 Standard format: Plasmid sent in bacteria as agar stab 1 $75
AAV5 50462-AAV5

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 6314
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
    Aequorea victoria
  • Insert Size (bp)
  • Promoter EF1a
  • Tag / Fusion Protein
    • N/A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc I (not destroyed)
  • 3′ cloning site Nhe I (not destroyed)
  • 5′ sequencing primer TTTTTGAGTTTGGATCTTGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Information for AAV5 (Catalog # 50462-AAV5) ( Back to top )


Ready-to-use AAV5 particles produced from pAAV-EF1a-DIO-mCherry (#50462). In addition to the viral particles, you will also receive purified pAAV-EF1a-DIO-mCherry plasmid DNA.

EF1a-driven mCherry-expression control. Cre-dependent. These AAV preparations are suitable purity for injection into animals.


  • Volume .
  • Titer ≥ 3×10¹² vg/mL
  • Pricing $350 USD for preparation of . virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry (Cre-dependent)


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-DIO-mCherry was a gift from Bryan Roth (Addgene plasmid # 50462 ; ; RRID:Addgene_50462)

    For viral preps, please replace (Addgene plasmid # 50462) in the above sentence with: (Addgene viral prep # 50462-AAV5)