pSLIK-NFLAG-hFUS
(Plasmid
#50487)
-
PurposeProduces lentivirus expressing human FUS with FLAG tag at its N-terminus by co-transfection with psPAX2 and pMD2G
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50487 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSLIK-neo
-
Backbone manufacturerIain Fraser(Addgene plasmid #25735)
- Backbone size w/o insert (bp) 13286
- Total vector size (bp) 14200
-
Vector typeLentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFUS
-
Alt namefused in sarcoma
-
Alt nameTLS
-
Alt namehnRNP P2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1680
-
GenBank IDNM_004960.3
-
Entrez GeneFUS (a.k.a. ALS6, ETM4, FUS1, HNRNPP2, POMP75, TLS, altFUS)
- Promoter TRE
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TGGAGACGCCATCCACGCTG
- 3′ sequencing primer CCATCTTTATGGCTCGAGATG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLIK-NFLAG-hFUS was a gift from Zissimos Mourelatos (Addgene plasmid # 50487 ; http://n2t.net/addgene:50487 ; RRID:Addgene_50487) -
For your References section:
FUS regulates genes coding for RNA-binding proteins in neurons by binding to their highly conserved introns. Nakaya T, Alexiou P, Maragkakis M, Chang A, Mourelatos Z. RNA. 2013 Apr;19(4):498-509. doi: 10.1261/rna.037804.112. Epub 2013 Feb 6. 10.1261/rna.037804.112 PubMed 23389473
Map uploaded by the depositor.