Skip to main content

pCFP Paxillin
(Plasmid #50510)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50510 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCFP NBC1
  • Backbone manufacturer
    Yamada lab
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Paxillin
  • Alt name
    PXN
  • Alt name
    focal adhesion protein, mutated
  • Species
    H. sapiens (human)
  • Entrez Gene
    PXN
  • Promoter CMV
  • Tag / Fusion Protein
    • ECFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CFP/YFP FW (TGAGCAAAGACCCCAACGAG)
  • 3′ sequencing primer EGFP RVs (CTCTACAAATGTGGTATGGCTG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Vector is a Clontech C1 vector with an MCS modification with original Bam HI mutation

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCFP Paxillin was a gift from Kenneth Yamada (Addgene plasmid # 50510 ; http://n2t.net/addgene:50510 ; RRID:Addgene_50510)