pECE beta1 R760A
(Plasmid #50511)

• Depositing Lab: Kenneth Yamada
• Publication: Pankov et al J Biol Chem. 2003 May 16;278(20):18671-81. Epub 2003 Mar 11.

Backbone

• Vector backbone: pECE
• Backbone manufacturer: Bill Rutter
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: integrin beta1
• Alt name: ITGB1
• Alt name: transmembrane glycoprotein
• Species: H. sapiens (human)
• Mutation: R760A
• Entrez Gene: ITGB1 (a.k.a. CD29, FNRB, GPIIA, MDF2, MSK12, VLA-BETA, VLAB)
• Promoter: SV40

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: pECE FW (CAAGTTAACAACAACAATTGC)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The original beta1 WT clone obtained from Dr. Ruoslahti had 5 AA differences from the published sequence, but the cytoplasmic domain sequence matched.