pECE beta1 R760A
(Plasmid
#50511)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50511 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepECE
-
Backbone manufacturerBill Rutter
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameintegrin beta1
-
Alt nameITGB1
-
Alt nametransmembrane glycoprotein
-
SpeciesH. sapiens (human)
-
MutationR760A
-
Entrez GeneITGB1 (a.k.a. CD29, FNRB, GPIIA, MDF2, MSK12, VLA-BETA, VLAB)
- Promoter SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pECE FW (CAAGTTAACAACAACAATTGC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The original beta1 WT clone obtained from Dr. Ruoslahti had 5 AA differences from the published sequence, but the cytoplasmic domain sequence matched.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pECE beta1 R760A was a gift from Kenneth Yamada (Addgene plasmid # 50511 ; http://n2t.net/addgene:50511 ; RRID:Addgene_50511) -
For your References section:
Specific beta1 integrin site selectively regulates Akt/protein kinase B signaling via local activation of protein phosphatase 2A. Pankov R, Cukierman E, Clark K, Matsumoto K, Hahn C, Poulin B, Yamada KM. J Biol Chem. 2003 May 16;278(20):18671-81. Epub 2003 Mar 11. 10.1074/jbc.M300879200 PubMed 12637511