Skip to main content

pGFP AH2 tensin
(Plasmid #50514)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50514 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGZ21dxZ
  • Backbone manufacturer
    Yamada Lab, Tamura et al., Science 280: 1614-7 (1998)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tensin
  • Alt name
    TNS1
  • Alt name
    cytoskeletal protein, domain
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    320
  • Mutation
    AA659--761, including actin homology 2 domain of tensin
  • Entrez Gene
    TNS1 (a.k.a. TNS)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GFP FW (AAAGACCCCAACGAGAAGCG)
  • 3′ sequencing primer GFP ASO (TTGTAACCATTATAAGCTGC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGFP AH2 tensin was a gift from Kenneth Yamada (Addgene plasmid # 50514 ; http://n2t.net/addgene:50514 ; RRID:Addgene_50514)
  • For your References section:

    Integrin dynamics and matrix assembly: tensin-dependent translocation of alpha(5)beta(1) integrins promotes early fibronectin fibrillogenesis. Pankov R, Cukierman E, Katz BZ, Matsumoto K, Lin DC, Lin S, Hahn C, Yamada KM. J Cell Biol. 2000 Mar 6;148(5):1075-90. 10.1083/jcb.148.5.1075 PubMed 10704455