-
PurposepTrc-trGPPS(CO)-LS: A plasmid that has truncated codon optimized geranylpyrophosphate synthase and truncated limonene synthase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 50603 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneE. coli DH10B
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameLimonene Synthase
-
Insert Size (bp)1634
-
Mutationtruncated codon optimized geranylpyrophosphate synthase
- Promoter Trc
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer GTCAGAATTAACCCGGGGA
- 3′ sequencing primer CCTGCAGGTCGACTCACTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameApR
-
Insert Size (bp)860
- Promoter Trc
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer ATTTGAACGTTGCGAAGCA
- 3′ sequencing primer TTTGCAAGCAGCAGATTACG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameLacIq
-
Insert Size (bp)1186
- Promoter Trc
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer GAGTCAGTGAGCGAGGAAGC
- 3′ sequencing primer NA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTrc-trGPPS(CO)-LS was a gift from Jay Keasling (Addgene plasmid # 50603 ; http://n2t.net/addgene:50603 ; RRID:Addgene_50603) -
For your References section:
Metabolic engineering of Escherichia coli for limonene and perillyl alcohol production. Alonso-Gutierrez J, Chan R, Batth TS, Adams PD, Keasling JD, Petzold CJ, Lee TS. Metab Eng. 2013 May 29;19C:33-41. doi: 10.1016/j.ymben.2013.05.004. 10.1016/j.ymben.2013.05.004 PubMed 23727191