Skip to main content
Addgene

ShuttleNSE
(Plasmid #50958)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50958 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pShuttle
  • Backbone manufacturer
    Bert Vogelstein lab (Addgene Plasmid #16402)
  • Backbone size (bp) 7981
  • Modifications to backbone
    A 1.1 kb portion of the rat NSE gene was PCR amplified using a forward primer containing AseI and AflII and a reverse primer containing BglII and PvuI sites. Primer sequences are as follows: GGGATTAATCTTAAGGGGACAGTAAAGGTGATGGC, 3’GGGAGATCTCGATCGGAGGACTGCAGACTCAGCC. The PCR product was digested with AseI and BglII and cloned into the AseI and BamHI cut pmRFP-N1 in place of the CMV promoter. The mRFP was removed from this plasmid with PvuI and XbaI and replaced with the PmeI-excised multi-cloning site of pcDNA3.1. The resulting NSE promoter/multicloning site/polyadenylation signal sequence cassette was excised by AflI partial digestion, the DNA fragment agarose gel purified, and then ligated (blunt end) into pShuttle cut with KpnI and SalI.
  • Vector type
    Mammalian Expression, Adenoviral
  • Promoter NSE

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer Encap-F (5'-TTTGGGCGTAACCGAGTAAG-3')
  • 3′ sequencing primer pShuttle-R (5'-CACAATGCTTCCATCAAACG-3')
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ShuttleNSE was a gift from James Bamburg (Addgene plasmid # 50958 ; http://n2t.net/addgene:50958 ; RRID:Addgene_50958)
  • For your References section:

    A genetically encoded reporter for real-time imaging of cofilin-actin rods in living neurons. Mi J, Shaw AE, Pak CW, Walsh KP, Minamide LS, Bernstein BW, Kuhn TB, Bamburg JR. PLoS One. 2013 Dec 31;8(12):e83609. doi: 10.1371/journal.pone.0083609. PubMed 24391794