pLA CMV N-Flag RALB V23 R47
(Plasmid
#50983)
-
PurposeExpresses RALB-V23/R47 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 50983 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLA
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRALB
-
SpeciesH. sapiens (human)
-
MutationG23V, K47R
-
Entrez GeneRALB
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer AACTCCTCATAAAGAGACAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOrfeome
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLA CMV N-Flag RALB V23 R47 was a gift from Anna Sablina (Addgene plasmid # 50983 ; http://n2t.net/addgene:50983 ; RRID:Addgene_50983) -
For your References section:
The deubiquitylase USP33 discriminates between RALB functions in autophagy and innate immune response. Simicek M, Lievens S, Laga M, Guzenko D, Aushev VN, Kalev P, Baietti MF, Strelkov SV, Gevaert K, Tavernier J, Sablina AA. Nat Cell Biol. 2013 Oct;15(10):1220-30. doi: 10.1038/ncb2847. Epub 2013 Sep 22. 10.1038/ncb2847 PubMed 24056301