-
PurposePhotoconverible Fluorescent Protein_ Fixative Resistant
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51072 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSETa
- Backbone size w/o insert (bp) 2900
- Total vector size (bp) 3584
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemEos4a
-
SpeciesSynthetic
-
Insert Size (bp)684
-
GenBank IDKJ126789
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GGGATGGGGATCCATGGTGAGTGCGATTAAGCCAGACAT
- 3′ sequencing primer GGGCCCCGAATTCTTATCGTCTGGCATTGTCAGGCAATC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSETa_ mEos4a was a gift from Loren Looger (Addgene plasmid # 51072 ; http://n2t.net/addgene:51072 ; RRID:Addgene_51072) -
For your References section:
Fixation-resistant photoactivatable fluorescent proteins for CLEM. Paez-Segala MG, Sun MG, Shtengel G, Viswanathan S, Baird MA, Macklin JJ, Patel R, Allen JR, Howe ES, Piszczek G, Hess HF, Davidson MW, Wang Y, Looger LL. Nat Methods. 2015 Jan 12. doi: 10.1038/nmeth.3225. 10.1038/nmeth.3225 PubMed 25581799