-
PurposeForebrain principal neuron expression of oChIEF kinetic variant E163A/T199C with physically uncoupled mKate2 red fluorophore
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51092 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-CaMKIIa-WPRE-HGHpA
-
Backbone manufacturercustom
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 7253
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameoChIEF(E163A/T199C)
-
Alt nameoChIEFac
-
SpeciesSynthetic
-
Insert Size (bp)1085
-
MutationE163A/T199C
- Promoter CaMKIIa
-
Tag
/ Fusion Protein
- P2A-mKate2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HpaI (not destroyed)
- 5′ sequencing primer aggagcacgggcaggcgagtgg
- 3′ sequencing primer CCATACGGGAAGCAATAGCATG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original oChIEF portion was obtained from John Lin and Roger Tsien (UCSD/HHMI)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The addition of the E163A and T199C mutations in oChIEF impart higher photocurrent amplitude while retaining fast kinetic properties. This variant is proposed as an alternative to ChETA variants that exhibit smaller photocurrents and more toxicity.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CaMKIIa-oChIEF(E163A/T199C)-P2A-mKate2 was a gift from Jonathan Ting (Addgene plasmid # 51092 ; http://n2t.net/addgene:51092 ; RRID:Addgene_51092)