Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #51084)


Item Catalog # Description Quantity Price (USD)
Plasmid 51084 Standard format: Plasmid sent in bacteria as agar stab 1 $65
AAV1 51084-AAV1 Virus (100 µL at titer ≥ 5×10¹² vg/mL) and Plasmid. More Information
AAV Retrograde 51084-AAVrg Virus (100µL at titer ≥ 7×10¹² vg/mL) and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Modified from Karl Deisseroth
  • Backbone size w/o insert (bp) 4590
  • Total vector size (bp) 6750
  • Modifications to backbone
    Altered cloning sites
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
    GCaMP6 slow
  • Species
  • Promoter human Synapsin1
  • Tag / Fusion Protein
    • P2A-nls-dTomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer ctcagcgctgcctcagtctg
  • 3′ sequencing primer CCATACGGGAAGCAATAGCATG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The addition of the P2A-nls-dTomato allows for easy identification of GCaMP6 expressing cells exhibiting nuclear red fluorescence that does not significantly overlap with the cytosolic GCaMP signal. The GCaMP and fluorophore are physically uncoupled.

Permissions were obtained from Douglas Kim and the Clontech licensing office for depositing this new plasmid.

Information for AAV1 (Catalog # 51084-AAV1) ( Back to top )


Ready-to-use AAV1 particles produced from AAV-hSyn1-GCaMP6s-P2A-nls-dTomato (#51084). In addition to the viral particles, you will also receive purified AAV-hSyn1-GCaMP6s-P2A-nls-dTomato plasmid DNA.

GCaMP6s calcium sensor and bicistronic, physically separate nuclear localized dTomato expression under a human synapsin1 promoter. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 5×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene nuclear dTomato (physically separate, not a fusion protein)


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Data submitted about 51084-AAV1 by requesting scientist(s):

Information for AAV Retrograde (Catalog # 51084-AAVrg) ( Back to top )


Ready-to-use AAV Retrograde particles produced from AAV-hSyn1-GCaMP6s-P2A-nls-dTomato (#51084). In addition to the viral particles, you will also receive purified AAV-hSyn1-GCaMP6s-P2A-nls-dTomato plasmid DNA.

GCaMP6s calcium sensor and bicistronic, physically separate nuclear localized dTomato expression under a human synapsin1 promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV retrograde (AAVrg)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene nuclear dTomato (physically separate, not a fusion protein)


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.

Data submitted about 51084-AAVrg by requesting scientist(s):

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-hSyn1-GCaMP6s-P2A-nls-dTomato was a gift from Jonathan Ting (Addgene plasmid # 51084 ; ; RRID:Addgene_51084)

    For viral preps, please replace (Addgene plasmid # 51084) in the above sentence with: (Addgene viral prep # 51084-AAV1) or (Addgene viral prep # 51084-AAVrg)