Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV-CaMKIIa-GCaMP6s-P2A-nls-dTomato
(Plasmid #51086)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51086 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-CaMKIIa-WPRE-BGHpA
  • Backbone manufacturer
    custom
  • Backbone size w/o insert (bp) 5095
  • Total vector size (bp) 7255
  • Modifications to backbone
    Altered cloning sites and replaced HGHpA with smaller BGHpA
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6s
  • Alt name
    G6s
  • Alt name
    GCaMP6 slow
  • Species
    Synthetic
  • Insert Size (bp)
    2160
  • Promoter CaMKIIa 1.3 kb
  • Tag / Fusion Protein
    • P2A-nls-dTomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer ttctccgtttgcactcaggagc
  • 3′ sequencing primer CCATACGGGAAGCAATAGCATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The GCaMP6s portion was derived from Addgene plasmid #40753 (Douglas Kim, Janelia Farms).

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The addition of the P2A-nls-dTomato allows for easy identification of GCaMP6 expressing cells exhibiting nuclear red fluorescence that does not significantly overlap with the cytosolic GCaMP signal. The GCaMP and fluorophore are physically uncoupled.

Permissions were obtained from Douglas Kim and the Clontech licensing office for depositing this new plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-CaMKIIa-GCaMP6s-P2A-nls-dTomato was a gift from Jonathan Ting (Addgene plasmid # 51086 ; http://n2t.net/addgene:51086 ; RRID:Addgene_51086)