Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV-EF1a-DIO-ChIEF(E162A/T198C)-P2A-dTomato-WPRE-BGHpA
(Plasmid #51095)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51095 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-EF1a-DIO-WPRE-BGHpA
  • Backbone manufacturer
    custom
  • Backbone size w/o insert (bp) 1047
  • Total vector size (bp) 7137
  • Modifications to backbone
    Altered cloning sites and replaced HGHpA with smaller BGHpA
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChIEF(E162A/T198C)
  • Alt name
    ChIEFac
  • Species
    Synthetic
  • Insert Size (bp)
    1085
  • Mutation
    E162A/T198C
  • Promoter EF1a
  • Tag / Fusion Protein
    • P2A-dTomato (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer gccagcttggcacttgatgtaattctcc
  • 3′ sequencing primer CCATACGGGAAGCAATAGCATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The original ChIEF portion was obtained from Roger Tsien (UCSD/HHMI) through 3rd party Ed Boyden (MIT). The Boyden construct containing ChIEF has a 10 aa truncation at the C terminus of ChIEF compared to the original ref sequence but was tested and confirmed as functional in the Boyden lab.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The addition of the E162A and T198C mutations in ChIEF impart higher photocurrent amplitude while retaining fast kinetic properties. This variant is proposed as an alternative to ChETA variants that exhibit smaller photocurrents and more toxicity.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-EF1a-DIO-ChIEF(E162A/T198C)-P2A-dTomato-WPRE-BGHpA was a gift from Jonathan Ting (Addgene plasmid # 51095 ; http://n2t.net/addgene:51095 ; RRID:Addgene_51095)