pIC291
(Plasmid
#51403)
-
PurposeRetroviral expression of EGFP-TEV-S-tag SKA1 for protein localization and affinity purification (LAP)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51403 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIC242
-
Backbone manufacturerAddgene Plasmid # 44432
- Backbone size w/o insert (bp) 5977
- Total vector size (bp) 6763
-
Modifications to backboneMob1A insert in pIC242 was removed and replaced by Ska1
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSka1 IMAGE 3909951
-
Alt nameC18orf24
-
SpeciesH. sapiens (human)
-
Insert Size (bp)768
-
Entrez GeneSKA1 (a.k.a. C18orf24)
-
Tags
/ Fusion Proteins
- EGFP (N terminal on backbone)
- TEV protease site (N terminal on backbone)
- S tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer GGCATGGACGAGCTGTACAAG
- 3′ sequencing primer GCATTCATTTTATGTTTCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIC291 was a gift from Iain Cheeseman (Addgene plasmid # 51403 ; http://n2t.net/addgene:51403 ; RRID:Addgene_51403) -
For your References section:
The human kinetochore Ska1 complex facilitates microtubule depolymerization-coupled motility. Welburn JP, Grishchuk EL, Backer CB, Wilson-Kubalek EM, Yates JR 3rd, Cheeseman IM. Dev Cell. 2009 Mar;16(3):374-85. doi: 10.1016/j.devcel.2009.01.011. 10.1016/j.devcel.2009.01.011 PubMed 19289083