Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #51403)


Item Catalog # Description Quantity Price (USD)
Plasmid 51403 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Addgene Plasmid # 44432
  • Backbone size w/o insert (bp) 5977
  • Total vector size (bp) 6763
  • Modifications to backbone
    Mob1A insert in pIC242 was removed and replaced by Ska1
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Ska1 IMAGE 3909951
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    SKA1 (a.k.a. C18orf24)
  • Tags / Fusion Proteins
    • EGFP (N terminal on backbone)
    • TEV protease site (N terminal on backbone)
    • S tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer GGCATGGACGAGCTGTACAAG
  • 3′ sequencing primer GCATTCATTTTATGTTTCAGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIC291 was a gift from Iain Cheeseman (Addgene plasmid # 51403 ; ; RRID:Addgene_51403)
  • For your References section:

    The human kinetochore Ska1 complex facilitates microtubule depolymerization-coupled motility. Welburn JP, Grishchuk EL, Backer CB, Wilson-Kubalek EM, Yates JR 3rd, Cheeseman IM. Dev Cell. 2009 Mar;16(3):374-85. doi: 10.1016/j.devcel.2009.01.011. 10.1016/j.devcel.2009.01.011 PubMed 19289083