Skip to main content

pGolden-AAV
(Plasmid #51424)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51424 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 2895
  • Total vector size (bp) 3358
  • Modifications to backbone
    pAAV-MCS (t3689g, g3686c), CMV-MCS replaced with lacZ
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    lacZ
  • Insert Size (bp)
    463
  • Promoter lacZ

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CTATCGAGACCGGCGCCGCTAC
  • 3′ sequencing primer CGCCAGAGACCACCGGTGGAAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGolden-AAV was a gift from Yonglun Luo (Addgene plasmid # 51424 ; http://n2t.net/addgene:51424 ; RRID:Addgene_51424)
  • For your References section:

    Efficient construction of rAAV-based gene targeting vectors by Golden Gate cloning. Luo Y, Lin L, Bolund L, Sorensen CB. Biotechniques. 2014 May 1;56(5):263-8. doi: 10.2144/000114169. eCollection 2014 May. 10.2144/000114169 PubMed 24806227