Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pGolden-AAV
(Plasmid #51424)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51424 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 2895
  • Total vector size (bp) 3358
  • Modifications to backbone
    pAAV-MCS (t3689g, g3686c), CMV-MCS replaced with lacZ
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    lacZ
  • Insert Size (bp)
    463
  • Promoter lacZ

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CTATCGAGACCGGCGCCGCTAC
  • 3′ sequencing primer CGCCAGAGACCACCGGTGGAAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGolden-AAV was a gift from Yonglun Luo (Addgene plasmid # 51424 ; http://n2t.net/addgene:51424 ; RRID:Addgene_51424)
  • For your References section:

    Efficient construction of rAAV-based gene targeting vectors by Golden Gate cloning. Luo Y, Lin L, Bolund L, Sorensen CB. Biotechniques. 2014 May 1;56(5):263-8. doi: 10.2144/000114169. eCollection 2014 May. 10.2144/000114169 PubMed 24806227