Skip to main content

TALEN-CCR5L18-CtermQ3
(Plasmid #51440)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51440 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    JDS70
  • Backbone manufacturer
    Joung lab
  • Backbone size w/o insert (bp) 5055
  • Total vector size (bp) 8058
  • Modifications to backbone
    TAL N-terminal: ∆152 (Miller et al. 2011) TAL C-terminus: +63 (Miller et al. 2011) FOKI: EL
  • Vector type
    Mammalian Expression, TALEN

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TALEN CCR5 Left (L18) Q3 C-term
  • Species
    Synthetic
  • Insert Size (bp)
    3003
  • Mutation
    K788Q, R792Q and R801Q
  • Promoter CMV
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • Fok1 EL variant (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer GCTGATCAGCGGGTTTAAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TALEN-CCR5L18-CtermQ3 was a gift from David Liu (Addgene plasmid # 51440 ; http://n2t.net/addgene:51440 ; RRID:Addgene_51440)
  • For your References section:

    Broad specificity profiling of TALENs results in engineered nucleases with improved DNA-cleavage specificity. Guilinger JP, Pattanayak V, Reyon D, Tsai SQ, Sander JD, Joung JK, Liu DR. Nat Methods. 2014 Apr;11(4):429-35. doi: 10.1038/nmeth.2845. Epub 2014 Feb 16. 10.1038/nmeth.2845 PubMed 24531420