pHTN HaloTag CMV-neo/ERGIC2-variant
(Plasmid
#51477)
-
PurposeExpresses ERGIC2-variant in mammalian cells, HaloTag for cellular localization
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51477 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHTN HaloTag CMV-neo
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6143
- Total vector size (bp) 7290
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameERGIC2
-
Alt namePTX1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1147
-
Mutation4 base deletion at codon #189
-
Entrez GeneERGIC2 (a.k.a. CDA14, Erv41, PTX1, cd002)
-
Tag
/ Fusion Protein
- HaloTag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CCAACCACTGATGATCTGTAC
- 3′ sequencing primer TCTTATCATGTCTGCTCGAAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHTN HaloTag CMV-neo/ERGIC2-variant was a gift from Simon Kwok (Addgene plasmid # 51477 ; http://n2t.net/addgene:51477 ; RRID:Addgene_51477) -
For your References section:
Characterization of a Variant of ERGIC2 Transcript. Kwok SC, Kumar S, Dai G. DNA Cell Biol. 2013 Dec 4. 10.1089/dna.2013.2225 PubMed 24303950