Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDNA6/ERGIC2-WT
(Plasmid #51479)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51479 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCDNA6
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 6255
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ERGIC2-WT
  • Alt name
    PTX1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1155
  • Mutation
    none
  • Entrez Gene
    ERGIC2 (a.k.a. CDA14, Erv41, PTX1, cd002)
  • Promoter CMV
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (filled-in) (destroyed during cloning)
  • 3′ cloning site XhoI (filled-in) (destroyed during cloning)
  • 5′ sequencing primer AATACGACTCACTATAGGGCGA
  • 3′ sequencing primer TAGAAGGCACAGTCGAGGCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA6/ERGIC2-WT was a gift from Simon Kwok (Addgene plasmid # 51479 ; http://n2t.net/addgene:51479 ; RRID:Addgene_51479)
  • For your References section:

    Molecular cloning, expression, localization, and gene organization of PTX1, a human nuclear protein that is downregulated in prostate cancer. Kwok SC, Liu X, Daskal I. DNA Cell Biol. 2001 Jun;20(6):349-57. 10.1089/10445490152122460 PubMed 11445006