Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

7Gli:GFP
(Plasmid #110494)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110494 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRRL.sin-18.ppt.TCF/LEF:GFP.pre
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    7 repeats of the Gli binding site GAACACCCA
  • Promoter 7 repeats of Gli biding site

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer n/a
  • 3′ sequencing primer gaacttcagggtcagcttgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    7Gli:GFP was a gift from Michael Lewis (Addgene plasmid # 110494 ; http://n2t.net/addgene:110494 ; RRID:Addgene_110494)
  • For your References section:

    Ubr3, a Novel Modulator of Hh Signaling Affects the Degradation of Costal-2 and Kif7 through Poly-ubiquitination. Li T, Fan J, Blanco-Sanchez B, Giagtzoglou N, Lin G, Yamamoto S, Jaiswal M, Chen K, Zhang J, Wei W, Lewis MT, Groves AK, Westerfield M, Jia J, Bellen HJ. PLoS Genet. 2016 May 19;12(5):e1006054. doi: 10.1371/journal.pgen.1006054. eCollection 2016 May. PGENETICS-D-15-03019 [pii] PubMed 27195754