-
Purposereporter of Hedgehog signaling activity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110494 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRRL.sin-18.ppt.TCF/LEF:GFP.pre
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name7 repeats of the Gli binding site GAACACCCA
- Promoter 7 repeats of Gli biding site
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer n/a
- 3′ sequencing primer gaacttcagggtcagcttgc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
7Gli:GFP was a gift from Michael Lewis (Addgene plasmid # 110494 ; http://n2t.net/addgene:110494 ; RRID:Addgene_110494) -
For your References section:
Ubr3, a Novel Modulator of Hh Signaling Affects the Degradation of Costal-2 and Kif7 through Poly-ubiquitination. Li T, Fan J, Blanco-Sanchez B, Giagtzoglou N, Lin G, Yamamoto S, Jaiswal M, Chen K, Zhang J, Wei W, Lewis MT, Groves AK, Westerfield M, Jia J, Bellen HJ. PLoS Genet. 2016 May 19;12(5):e1006054. doi: 10.1371/journal.pgen.1006054. eCollection 2016 May. PGENETICS-D-15-03019 [pii] PubMed 27195754