pNJB98
(Plasmid
#51520)
-
PurposeGateway entry vector with attL5 and attL2 sites flanking us:NPTII repair template sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51520 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNJB80
- Backbone size w/o insert (bp) 4249
- Total vector size (bp) 5421
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameus:nptII repair template
-
Insert Size (bp)2600
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer cagtcttacttccatgatttc
- 3′ sequencing primer tcagaagaactcgtcaagaagg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byus:nptII repair template was amplified by PCR from pDW1269 and cloned into pNJB80.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: a single nucleotide from the attL5 sequence is missing (an extra A should be at the 5' end of attL5).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNJB98 was a gift from Daniel Voytas (Addgene plasmid # 51520 ; http://n2t.net/addgene:51520 ; RRID:Addgene_51520) -
For your References section:
DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519