Skip to main content

pNJB98
(Plasmid #51520)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51520 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pNJB80
  • Backbone size w/o insert (bp) 4249
  • Total vector size (bp) 5421

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    us:nptII repair template
  • Insert Size (bp)
    2600

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer cagtcttacttccatgatttc
  • 3′ sequencing primer tcagaagaactcgtcaagaagg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    us:nptII repair template was amplified by PCR from pDW1269 and cloned into pNJB80.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: a single nucleotide from the attL5 sequence is missing (an extra A should be at the 5' end of attL5).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNJB98 was a gift from Daniel Voytas (Addgene plasmid # 51520 ; http://n2t.net/addgene:51520 ; RRID:Addgene_51520)
  • For your References section:

    DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519