pNJB99
(Plasmid
#51521)
-
PurposeGateway entry vector with attL1 and attR5 sites flanking Zif268:FokI coding sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51521 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNJB91
- Backbone size w/o insert (bp) 4659
- Total vector size (bp) 4033
-
Vector typeGateway entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZif268:FokI
-
Speciesfusion between human and bacterial genes
-
Insert Size (bp)897
-
Tag
/ Fusion Protein
- NLS (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site AttII (not destroyed)
- 5′ sequencing primer atggcttcctcccctccaaa
- 3′ sequencing primer attgatcccccctcgacagct
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byZif268:FokI was PCR amplified from pDW1345 and cloned into pNJB91.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNJB99 was a gift from Daniel Voytas (Addgene plasmid # 51521 ; http://n2t.net/addgene:51521 ; RRID:Addgene_51521) -
For your References section:
DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519