Skip to main content

Lyr_M37_KDEL
(Plasmid #51530)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 51530 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDNA3.1 (+) Zeo
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 6200
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lysine Racemase
  • Alt name
    Lyr
  • Species
    P. mirabilis
  • Insert Size (bp)
    1200
  • Mutation
    aa's 1-36 removed
  • Promoter CMV
  • Tags / Fusion Proteins
    • HA (C terminal on insert)
    • KDEL (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGACTCACTATAGGGAGACCCAAGC
  • 3′ sequencing primer CCTTCCAGGGTCAAGGAAGGCACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GeneArt
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Amino acids 1-36 were removed and a KDEL tag was added to limit extracellular localization. Please see the associated article for more information.

Note that the sequence here matches some putative database entries for alanine racemase, but the protein has been functionally characterised as lysine racemase

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lyr_M37_KDEL was a gift from Claus Jorgensen (Addgene plasmid # 51530 ; http://n2t.net/addgene:51530 ; RRID:Addgene_51530)
  • For your References section:

    Cell-specific labeling enzymes for analysis of cell-cell communication in continuous co-culture. Tape CJ, Norrie IC, Worboys JD, Lim L, Lauffenburger DA, Jorgensen C. Mol Cell Proteomics. 2014 May 12. 10.1074/mcp.O113.037119 PubMed 24820872