-
PurposeEctopic expression of Lyr with KDEL tag for CTAP
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51530 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDNA3.1 (+) Zeo
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6200
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLysine Racemase
-
Alt nameLyr
-
SpeciesP. mirabilis
-
Insert Size (bp)1200
-
Mutationaa's 1-36 removed
- Promoter CMV
-
Tags
/ Fusion Proteins
- HA (C terminal on insert)
- KDEL (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGACTCACTATAGGGAGACCCAAGC
- 3′ sequencing primer CCTTCCAGGGTCAAGGAAGGCACG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGeneArt
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Amino acids 1-36 were removed and a KDEL tag was added to limit extracellular localization. Please see the associated article for more information.
Note that the sequence here matches some putative database entries for alanine racemase, but the protein has been functionally characterised as lysine racemase
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lyr_M37_KDEL was a gift from Claus Jorgensen (Addgene plasmid # 51530 ; http://n2t.net/addgene:51530 ; RRID:Addgene_51530) -
For your References section:
Cell-specific labeling enzymes for analysis of cell-cell communication in continuous co-culture. Tape CJ, Norrie IC, Worboys JD, Lim L, Lauffenburger DA, Jorgensen C. Mol Cell Proteomics. 2014 May 12. 10.1074/mcp.O113.037119 PubMed 24820872