pCMV-myc-Rem2 S129N
(Plasmid
#51587)
-
Purposeexpresses RNAiR myc-tagged Rem2 non-GTP binding
-
Depositing Lab
-
Depositing OrganizationBrandeis University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51587 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 51587-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 51587-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRem2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1000
-
MutationS129N; silent mutations at shRNA 1 and 2 recognition sites (approx. AA 143-160)
-
Entrez GeneRem2 (a.k.a. AW411893)
- Promoter CMV
-
Tag
/ Fusion Protein
- myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC
- 3′ sequencing primer CATTCTAGTTGTGGTTTGTCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the sequence of the myc epitope tag in this plasmid is MQKLISEEDLL, which differs from the standard EQKLISEEDLL.
The Rem2 insert in this plasmid contains T13I and T15I mutations when compared to GenBank reference sequence NP_542764.2.
DNA (Catalog # 51587-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 51587-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-myc-Rem2 S129N was a gift from Suzanne Paradis (Addgene plasmid # 51587 ; http://n2t.net/addgene:51587 ; RRID:Addgene_51587) -
For your References section:
The GTPase Rem2 regulates synapse development and dendritic morphology. Ghiretti AE, Paradis S. Dev Neurobiol. 2011 May;71(5):374-89. doi: 10.1002/dneu.20868. 10.1002/dneu.20868 PubMed 21485012
