Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pcDNA3.1-aDTX-lumitoxin
(Plasmid #51686)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51686 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1+
  • Backbone size w/o insert (bp) 5341
  • Total vector size (bp) 6991
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    aDTX-lumitoxin
  • Alt name
    α-Dendrotoxin
  • Species
    Synthetic
  • Insert Size (bp)
    1650
  • GenBank ID
    KF878105
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer T7 (TAATACGACTCACTATAGGG)
  • 3′ sequencing primer BGHR (TAGAAGGCACAGTCGAGG)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-aDTX-lumitoxin was a gift from Edward Boyden (Addgene plasmid # 51686 ; http://n2t.net/addgene:51686 ; RRID:Addgene_51686)
  • For your References section:

    A fully genetically encoded protein architecture for optical control of peptide ligand concentration. Schmidt D, Tillberg PW, Chen F, Boyden ES. Nat Commun. 2014 Jan 10;5:3019. doi: 10.1038/ncomms4019. 10.1038/ncomms4019 PubMed 24407101