pcDNA3.1-DTXK-lumitoxin
(Plasmid
#51691)
-
PurposeExpression vector for DTXK-lumitoxin
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51691 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1+
- Backbone size w/o insert (bp) 5341
- Total vector size (bp) 6985
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDTXK-lumitoxin
-
Alt nameDendrotoxin-K
-
SpeciesSynthetic
-
Insert Size (bp)1644
-
GenBank IDKF878107
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer T7 (TAATACGACTCACTATAGGG)
- 3′ sequencing primer BGHR (TAGAAGGCACAGTCGAGG)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-DTXK-lumitoxin was a gift from Edward Boyden (Addgene plasmid # 51691 ; http://n2t.net/addgene:51691 ; RRID:Addgene_51691) -
For your References section:
A fully genetically encoded protein architecture for optical control of peptide ligand concentration. Schmidt D, Tillberg PW, Chen F, Boyden ES. Nat Commun. 2014 Jan 10;5:3019. doi: 10.1038/ncomms4019. 10.1038/ncomms4019 PubMed 24407101